Sequence ID | >WENV180043124 |
Genome ID | LQAH01003278 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2032 |
End posion on genome | 2107 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cagaagaaag |
tRNA gene sequence |
GCCGATATAGCTCAGTTGGTAGAGCATCTCACTTGTAATGAGAATGTCCTCCGTTCGATT |
Downstream region at tRNA end position |
aaataagggt |
Secondary structure (Cloverleaf model) | >WENV180043124 Thr TGT g TCCA aaataagggt G - C C - G C - G G - C A - T T - A A - T T T T G G G G C A T G A A | + | | | G T C T C G C T C C G C G | | | | T T G G A G C T A A ATGTC T - A C - G T - A C - G A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |