Sequence ID | >WENV180043146 |
Genome ID | LQAH01004202 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1733 |
End posion on genome | 1809 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cgattgatat |
tRNA gene sequence |
GCGCCCGTAGCTCATCCGGATAGAGCATCGGCCTTCTAAGCCGAGGGTAGCAGGTTCGAG |
Downstream region at tRNA end position |
ttcaaagcgg |
Secondary structure (Cloverleaf model) | >WENV180043146 Arg TCT t GCCA ttcaaagcgg G - C C - G G - C C - G C - G C - G G - C T G T C G T C C A C T A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTA T - A C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |