Sequence ID | >WENV180043150 |
Genome ID | LQAH01004298 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1342 |
End posion on genome | 1266 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
acaagagaat |
tRNA gene sequence |
GGGTCGGTAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
ttccccgatt |
Secondary structure (Cloverleaf model) | >WENV180043150 Ile GAT t ACCA ttccccgatt G - C G - C G - C T - A C - G G - C G + T T G T C C T C C A G G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |