Sequence ID | >WENV180043164 |
Genome ID | LQAH01004965 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 185 |
End posion on genome | 110 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcctcactgg |
tRNA gene sequence |
GGGCGGATAGCTCAGTTGGGAGAGCATCGGCCTTACAAGCCGAGGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
cctcagatac |
Secondary structure (Cloverleaf model) | >WENV180043164 Val TAC g ACCA cctcagatac G + T G - C G - C C - G G - C G - C A - T C G T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC T - A C - G G - C G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |