Sequence ID | >WENV180043185 |
Genome ID | LQAH01008349 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 910 |
End posion on genome | 993 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tcgggaaagt |
tRNA gene sequence |
GGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAACTCCCTCGCGGAGACGCACGCTAG |
Downstream region at tRNA end position |
ttctccccct |
Secondary structure (Cloverleaf model) | >WENV180043185 Tyr GTA t ACCA ttctccccct G - C G - C G - C C - G G - C A - T C - G T T A G A T C C A A C G | | | | | G A G C C G C T A G G C G + | | | T T G T G G C T G A CGCGGAGACGCACG G + T G - C G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |