Sequence ID | >WENV180043189 |
Genome ID | LQAH01009231 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 435 |
End posion on genome | 508 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccacagggct |
tRNA gene sequence |
GGCGAGTTGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACACCGGTTCGATTCC |
Downstream region at tRNA end position |
tttaaaatca |
Secondary structure (Cloverleaf model) | >WENV180043189 Cys GCA t TCCA tttaaaatca G - C G - C C - G G - C A - T G - C T - A T T T T G G C C A G A G | | | | | G T G G C G A C C G G C G | | | T T G A C G C T G A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |