Sequence ID | >WENV180043209 |
Genome ID | LQAH01010676 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 432 |
End posion on genome | 508 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ttcgtgacgt |
tRNA gene sequence |
CGGGATGTAGCGCAGCCTGGGAGCGCACTTGAATGGGGTTCAAGGGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
cgtcaaaaag |
Secondary structure (Cloverleaf model) | >WENV180043209 Pro GGG t ACCA cgtcaaaaag C - G G - C G - C G - C A - T T - A G - C T A T T C T C C A C G A A + | | | | A C C G C G G G A G G C T | | | | T T G G C G C G G A A GGGTC C - G T - A T - A G - C A - T A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |