Sequence ID | >WENV180043216 |
Genome ID | LQAH01011042 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 233 |
End posion on genome | 308 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ccgcaccagg |
tRNA gene sequence |
GCCGCTGTAGCTCAGCTGGTAGAGCACGTCATTCGTAATGATGGGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
cttctgcacc |
Secondary structure (Cloverleaf model) | >WENV180043216 Thr CGT g ACCA cttctgcacc G - C C - G C - G G - C C - G T - A G - C T G T T T C C C A C G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GGGTC C - G G + T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |