Sequence ID | >WENV180043229 |
Genome ID | LQAH01012545 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 53 |
End posion on genome | 142 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tctcccaagc |
tRNA gene sequence |
GGAGAGGTGTCCGAGTCCGGCTTAAGGAGCACGCCTGGAAAGCGTGTATAGTTAACGCTA |
Downstream region at tRNA end position |
gtaaattcaa |
Secondary structure (Cloverleaf model) | >WENV180043229 Ser GGA c GCCA gtaaattcaa G - C G - C A - T G - C A - T G - C G - C T A T T C T C C A C T G A G + | | | | G C G C C T G G A G G C G | | | T T G A G G A C T T A G TATAGTTAACGCTATC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |