Sequence ID | >WENV180043267 |
Genome ID | LQAH01018197 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 421 |
End posion on genome | 495 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgctcaccgt |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCAGCGGTTTTTGGTACCGTGTATCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tgatccataa |
Secondary structure (Cloverleaf model) | >WENV180043267 Gln TTG t GCCA tgatccataa T - A G - C G - C G - C G - C T - A G - C T A T C A T C C A G A A | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GTATC G + T C - G G - C G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |