Sequence ID | >WENV180043285 |
Genome ID | LQAH01022362 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 612 |
End posion on genome | 523 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agcgcagcac |
tRNA gene sequence |
GGAGCGGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTAGGCGGGAGACCGTC |
Downstream region at tRNA end position |
ttatccccca |
Secondary structure (Cloverleaf model) | >WENV180043285 Ser GGA c GCCA ttatccccca G - C G - C A - T G - C C - G G - C G + T T A T G T C C C A T G A G | | | | | G G G C C G C A G G G C G | | | T T T A G G C C G A G TAGGCGGGAGACCGTCTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |