Sequence ID | >WENV180043302 |
Genome ID | LQAH01026154 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 195 |
End posion on genome | 119 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tctcactcgt |
tRNA gene sequence |
GGCGGAGTAGCTCAGTTGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCAAG |
Downstream region at tRNA end position |
ctgcaccccc |
Secondary structure (Cloverleaf model) | >WENV180043302 Met CAT t ACCA ctgcaccccc G + T G - C C - G G - C G - C A - T G - C T G T C T C C C A T G A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C T T A A GTGTC G - C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |