Sequence ID | >WENV180043322 |
Genome ID | LQAH01028726 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 215 |
End posion on genome | 142 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tcaagtccca |
tRNA gene sequence |
GGGCGCATAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
gagagaatat |
Secondary structure (Cloverleaf model) | >WENV180043322 Val TAC a ACtc gagagaatat G - C G - C G - C C - G G - C C - G A - T C G T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |