Sequence ID | >WENV180043332 |
Genome ID | LQAH01030195 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 416 |
End posion on genome | 492 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tgtatgagct |
tRNA gene sequence |
GGGTCTGTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGCTGGTTCAAC |
Downstream region at tRNA end position |
atcatggggn |
Secondary structure (Cloverleaf model) | >WENV180043332 Ile GAT t ACCA atcatggggn G - C G - C G - C T - A C - G T - A G - C T C T C G A C C A T G A A | | | | | A T C T C G G C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |