Sequence ID | >WENV180043336 |
Genome ID | LQAH01031889 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 133 |
End posion on genome | 208 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gacgctcatc |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCGCTTCGTTTACACCGAAGATGTCGGGAGTTCGAGC |
Downstream region at tRNA end position |
tcccatccgt |
Secondary structure (Cloverleaf model) | >WENV180043336 Val TAC c ACCA tcccatccgt G - C G - C G - C T - A C - G G - C T - A C G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G T - A T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |