Sequence ID | >WENV180043343 |
Genome ID | LQAH01033027 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 178 |
End posion on genome | 104 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tttcaaatgt |
tRNA gene sequence |
TCCAAGGTAGCTCAATGGTGGAGCAACCGGCTGTTAACCGGTAGGCTGTGGGTTCGAGTC |
Downstream region at tRNA end position |
ataatattgc |
Secondary structure (Cloverleaf model) | >WENV180043343 Asn GTT t GCCA ataatattgc T - A C - G C - G A - T A - T G - C G - C T G T C A C C C A A A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T G A AGGCT A - T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |