Sequence ID | >WENV180043348 |
Genome ID | LQAH01033973 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 130 |
End posion on genome | 204 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
attgtttggg |
tRNA gene sequence |
GGGGAATTAGCTCAGTTGGCTAGAGCGCTAGATTTGCATTCTAGAGGTCAAGGGTTCGAC |
Downstream region at tRNA end position |
ttgatataaa |
Secondary structure (Cloverleaf model) | >WENV180043348 Ala TGC g ACag ttgatataaa G - C G - C G + T G - C A - T A - T T - A T C T T T C C C A T G A A | | | | | G T C T C G A A G G G C G | | | | T T G G A G C C T A G AGGTC C - G T - A A - T G - C A - T T T T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |