Sequence ID | >WENV180043349 |
Genome ID | LQAH01034132 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 101 |
End posion on genome | 177 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aggcccaagc |
tRNA gene sequence |
GGTCCCTTAGCTCAACTGGATAGAGCAGCTGACTTCTAATCAGCAGGTTGAGGGTTCGAG |
Downstream region at tRNA end position |
gatttctatt |
Secondary structure (Cloverleaf model) | >WENV180043349 Arg TCT c GCCA gatttctatt G - C G + T T - A C - G C - G C - G T - A T G T C T T C C A C A A A | | + | | G T C T C G G A G G G C G | | | | T T G G A G C A T A A AGGTT G - C C - G T - A G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |