Sequence ID | >WENV180043351 |
Genome ID | LQAH01034481 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 144 |
End posion on genome | 218 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ttctcgttgc |
tRNA gene sequence |
TGGGACATCGTTCAATTGGCAGGACGACGGGTTCTGGTTCCGTTAATCAAGGTTCGAGTC |
Downstream region at tRNA end position |
acaacaaatt |
Secondary structure (Cloverleaf model) | >WENV180043351 Gln CTG c GCCA acaacaaatt T - A G - C G - C G - C A - T C - G A - T T G T G T T C C A T A A C | | | | | G T C T T G C A A G G C G | + | | T T G G G A C C A G TAAT A - T C - G G - C G - C G + T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |