Sequence ID | >WENV180043360 |
Genome ID | LQAH01036611 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 104 |
End posion on genome | 190 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tacacctctt |
tRNA gene sequence |
GCCGAGGTGGTGGAACTGGTAGACACGCTGTCTTGAGGGGGCAGTGGAAGAGATTCCGTG |
Downstream region at tRNA end position |
tgcaacagaa |
Secondary structure (Cloverleaf model) | >WENV180043360 Leu GAG t ACCA tgcaacagaa G - C C - G C - G G - C A - T G - C G - C T A T C C C C C A C A A G | | | | | G T G G T G G G G G G C G | | | T T G A C A C T A G G TGGAAGAGATTCCGT C - G T - A G - C T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |