Sequence ID | >WENV180043372 |
Genome ID | LQAH01038010 |
Phylum/Class | [LQAH] bioreactor metagenome; bioreactor_4 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 294 |
End posion on genome | 208 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
nnnnnnnngt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTAGGTTCAGGGTCTAGTGGAGGTTTCTCCGTG |
Downstream region at tRNA end position |
tatttctgaa |
Secondary structure (Cloverleaf model) | >WENV180043372 Leu CAG t ACCA tatttctgaa G - C C - G C - G G - C A - T A - T G - C T G T T C T T C A T A A G + | | | | G T G G T G G G A A G C G | | | T T G A C A C T A G G TGGAGGTTTCTCCGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |