Sequence ID | >WENV180043513 |
Genome ID | LQAI01000178 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 12040 |
End posion on genome | 12124 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ccaaaataag |
tRNA gene sequence |
GGTGGGGTTCCCGAGTGGTCAAAGGGATCAGACTGTAAATCTGACGGCTCAGCCTTCGGA |
Downstream region at tRNA end position |
taaatgtagg |
Secondary structure (Cloverleaf model) | >WENV180043513 Tyr GTA g ACCA taaatgtagg G - C G - C T - A G - C G - C G - C G - C T A T C C T C C A T G A T | | | | | A G G C C C G G A G G C G | | | T T T A G G G C A A A CGGCTCAGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |