Sequence ID | >WENV180043538 |
Genome ID | LQAI01000466 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 5418 |
End posion on genome | 5342 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tcgatagagc |
tRNA gene sequence |
AGGGGTATAGTTCCAACGGCTAGAACGCCGGTCTCCAAAACCGGATGTTGGGGGTTCGAA |
Downstream region at tRNA end position |
attaagtctt |
Secondary structure (Cloverleaf model) | >WENV180043538 Trp CCA c GCCA attaagtctt A - T G - C G - C G - C G - C T - A A - T T A T C T C C C A A A C A | + | | | G C C T T G G G G G G C G | | | | T T G G A A C C T A G ATGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |