Sequence ID | >WENV180043542 |
Genome ID | LQAI01000520 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 6396 |
End posion on genome | 6468 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tgcgaatttt |
tRNA gene sequence |
GCCGATGTAGCTCAATGGTAGAGCAATCGCCTTGTAAGTGATAGGTTATGGGTTCGATTC |
Downstream region at tRNA end position |
gttacacgtt |
Secondary structure (Cloverleaf model) | >WENV180043542 Thr TGT t TCag gttacacgtt G - C C - G C - G G - C A - T T - A G - C T T T T A C C C A A A A | | | | | G T C T C G A T G G G C G | | | | T T G G A G C T A A AGGTT A - T T - A C - G G + T C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |