Sequence ID | >WENV180043599 |
Genome ID | LQAI01001838 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2641 |
End posion on genome | 2566 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tgaacggagt |
tRNA gene sequence |
GGGTCACTAGCTCAATTGGCAGAGCAGCGGACTCTTAATCCGGAGGTTCAAGGTTCGATT |
Downstream region at tRNA end position |
ctctgaatat |
Secondary structure (Cloverleaf model) | >WENV180043599 Lys CTT t ACCA ctctgaatat G - C G - C G - C T - A C - G A - T C - G T T T G T T C C A T A A A | | | | | G T C T C G C A A G G C G | | | | T T G G A G C C A A AGGTT G G C - G G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |