Sequence ID | >WENV180043605 |
Genome ID | LQAI01002272 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2432 |
End posion on genome | 2508 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
taggtagaat |
tRNA gene sequence |
GGGCCTATAGCTCAGCTGGCTAGAGCGCTCGACTGATAATCGTGAGGTCCCAGGTTCAAG |
Downstream region at tRNA end position |
tgataatctg |
Secondary structure (Cloverleaf model) | >WENV180043605 Ile GAT t ACCA tgataatctg G - C G - C G - C C - G C - G T - A A - T T G T G G T C C A C G A A | | | | | A T C T C G C C A G G C G | | | | T T G G A G C C T A G AGGTC C - G T T C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |