Sequence ID | >WENV180043606 |
Genome ID | LQAI01002272 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2524 |
End posion on genome | 2599 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
atctgtagat |
tRNA gene sequence |
GGGGAATTAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
tctataaaaa |
Secondary structure (Cloverleaf model) | >WENV180043606 Ala TGC t ACCA tctataaaaa G - C G - C G + T G - C A - T A - T T - A C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |