Sequence ID | >WENV180043618 |
Genome ID | LQAI01002715 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 1697 |
End posion on genome | 1609 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tttaatatcc |
tRNA gene sequence |
GGAGAGGTACCGAAGTGGTCATAACGGGGCGGTCTTGAAAACCGTTAGGGTGCAAGCCCA |
Downstream region at tRNA end position |
aattaacctg |
Secondary structure (Cloverleaf model) | >WENV180043618 Ser TGA c GCCA aattaacctg G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A G T G A A | | | | | G G A G C C G A G G G C T | | | T T C A C G G A T A G TAGGGTGCAAGCCCAC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |