Sequence ID | >WENV180043676 |
Genome ID | LQAI01006630 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 954 |
End posion on genome | 878 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
attatagtgc |
tRNA gene sequence |
GGAGCCGTAGTTAAGCTGGTTATAACGCCGGCCTGTCACGCCGGAGGCCGCGAGTTCGAG |
Downstream region at tRNA end position |
ctaaagacca |
Secondary structure (Cloverleaf model) | >WENV180043676 Asp GTC c GCCA ctaaagacca G - C G - C A - T G - C C - G C - G G - C T G T T G C T C A C G A A + | | | | G T A T T G G C G A G C G | | | | T T G T A A C T T A G AGGCC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |