Sequence ID | >WENV180043721 |
Genome ID | LQAI01012079 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 322 |
End posion on genome | 398 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ttcatgttgt |
tRNA gene sequence |
GGGTGATTAGCTCAGTTGGTTAGAGTGCTACGTTGACATCGTAGAGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
tttttgttag |
Secondary structure (Cloverleaf model) | >WENV180043721 Val GAC t ACCA tttttgttag G - C G - C G - C T - A G - C A - T T - A T A T T G C C C A T G A A | | | | G T C T C G A C A G G C G | | | + T T G G A G T T T A G AGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |