Sequence ID | >WENV180043730 |
Genome ID | LQAI01012948 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 7 |
End posion on genome | 89 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
nnnnttcctt |
tRNA gene sequence |
GCGGATGTGGCGTAATTGGTAGCCGCGCTAGACTTAGGATCTAGTGCCTTCGGGCGTGGG |
Downstream region at tRNA end position |
aattttttag |
Secondary structure (Cloverleaf model) | >WENV180043730 Leu TAG t ACat aattttttag G - C C - G G - C G - C A - T T - A G - C T G T T T C C C A T A A G + + | | | G T T G C G G G G G G C G | | | T T G C C G C T A G G TGCCTTCGGGCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |