Sequence ID | >WENV180043734 |
Genome ID | LQAI01013189 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 213 |
End posion on genome | 288 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgccatttac |
tRNA gene sequence |
GCCTCGGTAGCTCAGTTGGTAGAGCAAGGGACTGAAAATCCCTGTGTCGACAGTTCGATT |
Downstream region at tRNA end position |
agtataatct |
Secondary structure (Cloverleaf model) | >WENV180043734 Phe GAA c ACCA agtataatct G - C C - G C - G T - A C - G G + T G - C T T T C T G T C A T G A A | | | | | G T C T C G G A C A G C G | | | | T T G G A G C T A A GTGTC A - T G - C G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |