Sequence ID | >WENV180043748 |
Genome ID | LQAI01014937 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 276 |
End posion on genome | 202 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
agtcccgaaa |
tRNA gene sequence |
TGGCGCGTAGCTCAGCTGGTTAGAGCGCACGGTTCACATCCGTGAGGTCGATGGTTCGAG |
Downstream region at tRNA end position |
tttaaaaacc |
Secondary structure (Cloverleaf model) | >WENV180043748 Val CAC a ACta tttaaaaacc T C G - C G - C C - G G - C C - G G - C T G T T T A C C A C G A A + | | | | G T C T C G G A T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |