Sequence ID | >WENV180043782 |
Genome ID | LQAI01019457 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 370 |
End posion on genome | 295 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cggcaagcat |
tRNA gene sequence |
TCCCCAGTGGCTCAATTGGCAGAGCGGGTGACTGTTAATCACTAGGTTCGCGGTTCAAGT |
Downstream region at tRNA end position |
agagaaatca |
Secondary structure (Cloverleaf model) | >WENV180043782 Asn GTT t GCCA agagaaatca T - A C - G C - G C - G C - G A - T G - C T G T G T G C C A T A A G | + | | | A T C T C G C G C G G C G | | | | T T G G A G C C A G AGGTT G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |