Sequence ID | >WENV180043790 |
Genome ID | LQAI01020402 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 55 |
End posion on genome | 129 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaacaactat |
tRNA gene sequence |
TCCAAGGTAGCTCAACGGTGGAGCAACCGGCTGTTAACCGGTAGGCTGTGGGTTCGAGTC |
Downstream region at tRNA end position |
aacttattga |
Secondary structure (Cloverleaf model) | >WENV180043790 Asn GTT t GCCA aacttattga T - A C - G C - G A - T A - T G - C G - C T G T C A C C C A A A A | | | | | G C C T C G G T G G G C G | | | | T T G G A G C T G A AGGCT A - T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |