Sequence ID | >WENV180043796 |
Genome ID | LQAI01020734 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 78 |
End posion on genome | 154 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gatatcttat |
tRNA gene sequence |
GTCAAGGTAGCTCAGCTGGCTAGAGCGCTGGTCTCATAAGCCGGAGGTCGAGGGTTCGAG |
Downstream region at tRNA end position |
ttcgtaagtc |
Secondary structure (Cloverleaf model) | >WENV180043796 Met CAT t ACCA ttcgtaagtc G - C T - A C - G A - T A - T G - C G + T T G T C T C C C A C G A A | | | | | G T C T C G G A G G G C G | | | | T T G G A G C C T A G AGGTC C - G T + G G - C G - C T + G C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |