Sequence ID | >WENV180043803 |
Genome ID | LQAI01020927 |
Phylum/Class | [LQAI] bioreactor metagenome; bioreactor_5 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 170 |
End posion on genome | 246 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ttcataaaaa |
tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCAAA |
Downstream region at tRNA end position |
ctttttaagc |
Secondary structure (Cloverleaf model) | >WENV180043803 Ile GAT a ACCA ctttttaagc G - C G - C G - C C - G C - G T - A G - C T A T C C A C C A T G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |