Sequence ID | >WENV180043820 |
Genome ID | LQAJ01000001 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 75355 |
End posion on genome | 75427 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
acgtatacca |
tRNA gene sequence |
GGGCCGTTAGCTCAGCTGGTAGAGCAGCAGACTCTTAATCTGCGGGTCGAAGGTTCGATC |
Downstream region at tRNA end position |
cagcaagaag |
Secondary structure (Cloverleaf model) | >WENV180043820 Lys CTT a Attg cagcaagaag G - C G + T G - C C - G C - G G - C T - A C T T C T T C C A C G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A GGGTC G - C C - G A - T G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |