Sequence ID | >WENV180043828 |
Genome ID | LQAJ01000001 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 6894 |
End posion on genome | 6821 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
attggttaaT |
tRNA gene sequence |
GTCTCCTTCGTCTAGTGGTTAGGACACCGGGTTTTCATCCCGGCAACAGGGGTTCAATTC |
Downstream region at tRNA end position |
gcatcttgtt |
Secondary structure (Cloverleaf model) | >WENV180043828 Glu TTC T GTgc gcatcttgtt G + T T - A C - G T - A C - G C - G T - A T T T T C C C C A T G A C | | | | | A G T C T G A G G G G C G + | | | T T T G G A C T A A CAAC C - G C - G G - C G - C G - C T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |