Sequence ID | >WENV180043887 |
Genome ID | LQAJ01000044 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 111633 |
End posion on genome | 111558 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tgctgctcac |
tRNA gene sequence |
GCCCAGGTAGCTCAGTCGGTAGAGCAGGGGACTGAAAATCCCCGTGTCAGCAGTTCGATT |
Downstream region at tRNA end position |
gattttaaaa |
Secondary structure (Cloverleaf model) | >WENV180043887 Phe GAA c ACCA gattttaaaa G - C C - G C - G C - G A - T G - C G - C T T T T T G T C A T G A A | + | | | G C C T C G A G C A G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |