Sequence ID | >WENV180043903 |
Genome ID | LQAJ01000052 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 109659 |
End posion on genome | 109585 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
nnntttattt |
tRNA gene sequence |
GGCCCCTTGGTCAAGTGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAATC |
Downstream region at tRNA end position |
cttaatttaa |
Secondary structure (Cloverleaf model) | >WENV180043903 Glu TTC t ACCA cttaatttaa G - C G + T C - G C - G C - G C - G T - A T A T T C C C C A T G A G | | | | | G G A C T G A G G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |