Sequence ID | >WENV180043975 |
Genome ID | LQAJ01000139 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 29221 |
End posion on genome | 29297 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cttctcgcgt |
tRNA gene sequence |
CGGGATGTAGCGCAGCTTGGGAGCGCACTTGAATGGGGTTCAAGGGGTCGAAGGTTCAAA |
Downstream region at tRNA end position |
acgaatgaaa |
Secondary structure (Cloverleaf model) | >WENV180043975 Pro GGG t ACCA acgaatgaaa C - G G - C G - C G - C A - T T - A G - C T A T T T T C C A C G A A + | | | | A T C G C G G A A G G C T | | | | T T G G C G C G G A A GGGTC C - G T - A T - A G - C A - T A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |