Sequence ID | >WENV180043981 |
Genome ID | LQAJ01000166 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 20314 |
End posion on genome | 20388 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tcgcttttga |
tRNA gene sequence |
GCGGGAATAACTCAGTGGTAGAGTGCAACCTTGCCAAGGTTGAAGTCGCGAGTTCAAATC |
Downstream region at tRNA end position |
gaatatacaa |
Secondary structure (Cloverleaf model) | >WENV180043981 Gly GCC a TCCA gaatatacaa G - C C - G G - C G - C G - C A - T A - T T A T T G C T C A G A A + | | | | A T C T C A G C G A G C G | | | | T T G G A G T T A G AAGTC C - G A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |