Sequence ID | >WENV180043984 |
Genome ID | LQAJ01000172 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 21216 |
End posion on genome | 21291 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
catggactac |
tRNA gene sequence |
GGGCCAGTAGCTCAGTTGGCAGAGCCACCGGCTCATAACCGGTCGGTCCCAGGTTCGAAT |
Downstream region at tRNA end position |
tcttccccct |
Secondary structure (Cloverleaf model) | >WENV180043984 Ile2 CAT c ACCA tcttccccct G - C G - C G - C C - G C - G A - T G - C T A T G G T C C A T G A A | | | | | G T C T C G C C A G G C G | | | | T T G G A G C C A C CGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |