Sequence ID | >WENV180044000 |
Genome ID | LQAJ01000193 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 22152 |
End posion on genome | 22078 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ttcaacgaga |
tRNA gene sequence |
AGGCGCGTAGCTCAGGGGGAGAGCATTTGCTTGACGTGCAAAGGGTCGTGGGTTCAAATC |
Downstream region at tRNA end position |
gaaatccccg |
Secondary structure (Cloverleaf model) | >WENV180044000 Val GAC a ACCA gaaatccccg A - T G - C G - C C - G G - C C - G G - C T A T C T C C C A G A A | | | | A G C T C G G T G G G C G | | | | T T G G A G C G A A GGGTC T - A T - A T - A G - C C - G T T T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |