Sequence ID | >WENV180044004 |
Genome ID | LQAJ01000200 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 8588 |
End posion on genome | 8512 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
attatagtgc |
tRNA gene sequence |
GGAGCCGTAGTTAAGCTGGTTATAACGCCGGCCTGTCACGCCGGAGGCCGCGAGTTCGAG |
Downstream region at tRNA end position |
gttaaagaac |
Secondary structure (Cloverleaf model) | >WENV180044004 Asp GTC c GCCA gttaaagaac G - C G - C A - T G - C C - G C - G G - C T G T T G C T C A C G A A + | | | | G T A T T G G C G A G C G | | | | T T G T A A C T T A G AGGCC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |