Sequence ID | >WENV180044008 |
Genome ID | LQAJ01000252 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 2209 |
End posion on genome | 2134 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cctcaacacg |
tRNA gene sequence |
GTGGGTGTAGCTCAGTTGGTAGAGCACTTGGTTGTGGCCCAAGTGGCCGTGGGTTCAAGT |
Downstream region at tRNA end position |
gagcataatc |
Secondary structure (Cloverleaf model) | >WENV180044008 His GTG g CCCA gagcataatc G - C T - A G - C G + T G - C T - A G - C T G T T A C C C A T G A A + | | | | A T C T C G G T G G G C G | | | | T T G G A G C T A A TGGCC C - G T - A T - A G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |