Sequence ID | >WENV180044013 |
Genome ID | LQAJ01000289 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 8088 |
End posion on genome | 8004 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgttcttttt |
tRNA gene sequence |
GCGGGCGTGGCGGAATTGGTAAACGCGCCAGATTTAGGATCTGGTACCTCGCGGTTTGGG |
Downstream region at tRNA end position |
gattgcagtt |
Secondary structure (Cloverleaf model) | >WENV180044013 Leu TAG t ACCA gattgcagtt G - C C - G G - C G - C G - C C - G G - C T G T C T C C C A T A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T A A G TACCTCGCGGTTT C - G C - G A - T G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |