Sequence ID | >WENV180044021 |
Genome ID | LQAJ01000333 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 11822 |
End posion on genome | 11913 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gtccggcaac |
tRNA gene sequence |
GGAGAGGTGGCAGAGCTCGGTTTAATGCGCTGGTCTTGAAAACCAGAGGCGGGGCAACTC |
Downstream region at tRNA end position |
annnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180044021 Ser TGA c GCCA annnnnnnnn G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T C G A G | + | | | G C G A C G G G G G G C G | | | T T G A T G C T T T A G AGGCGGGGCAACTCGTCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |