Sequence ID | >WENV180044027 |
Genome ID | LQAJ01000364 |
Phylum/Class | [LQAJ] bioreactor metagenome; bioreactor_6 inoculated with Wadden Sea sediment; 2nd replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 3096 |
End posion on genome | 3019 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tcgcatcatc |
tRNA gene sequence |
GTCCCCATCGTCTAGTCTGGTCCAGGACGGCGGCCTTTCACGCCGTTAACAGGGGTTCAA |
Downstream region at tRNA end position |
tgcatagaat |
Secondary structure (Cloverleaf model) | >WENV180044027 Glu TTC c GCCA tgcatagaat G - C T - A C - G C - G C - G C - G A - T T A T T C C C C A C T G A C | | | | | A T T C T G A G G G G C G + | | | T T G G G A C T C C A G TAAC G + T C - G G - C G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |